NCERT Solutions for Class 12 Biology Chapter 6 - Molecular Basis of Inheritance

Chapter 6 of Class 12 Biology in Aakash NCERT Solutions focuses on the Molecular Basis of Inheritance, a crucial topic for understanding genetics. The chapter begins by exploring the search for genetic material, highlighting how scientists discovered that DNA carries genetic information. This section emphasizes the experiments conducted by key figures like Griffith and Avery, which laid the groundwork for our understanding of heredity.

Next, the chapter introduces the RNA world hypothesis, suggesting that early life forms might have used RNA for both genetic information and catalysis. This is an essential concept that illustrates the evolution of life.

The topic of replication follows, explaining how DNA is copied during cell division. Students learn about enzymes like DNA polymerase and the steps involved in this process.

The chapter also covers the genetic code, detailing how sequences of nucleotides in DNA correspond to specific amino acids in proteins.

Another significant area discussed is the regulation of gene expression, where students discover how cells control which genes are turned on or off.

Lastly, the chapter touches on important projects like the Human Genome Project and techniques such as DNA fingerprinting, showcasing their applications in medicine and forensic science. This comprehensive overview prepares students for advanced studies in biology and genetics.

Class 12 Biology Chapter 6 Molecular Basis of Inheritance NCERT Notes, Question and Answers PDF

1. Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Answer:

Nitrogenous bases- Adenine, thymine, uracil and cytosine
Nucleosides- Cytidine and guanosine

2. If a double stranded DNA has 20 percent of cytosine, calculate the percent of adenine in the DNA.
Answer:

By Chargaff's rule, we know that at A=T and G=C. Since there are 20% cytosines, guanine percentage will also be 20%. G+C count is 20+20= 40%. Therefore, the remaining 60% will be contributed equally by adenine and thymine. Thus, the percentage of adenine and thymine are 30% each.

3. If the sequence of one strand of DNA is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strands in 5’-3’  direction.
Answer:

With regard to base pairs the DNA strands are complementary to each other. So, if the sequence of DNA is

5'-ATGCATGCATGCATGCATGCATGCATGC-3'

The sequence of the complementary strand will be

3`- TACGTACGTACGTACGTACGTACGTACG - 5`.

          In 5’ - 3’ strand it can be written as - 

5'- ATGCATGCATGCATGCATGCATGCATGC-3'

4. If the sequence of the coding strand in a transcription unit is written as follows:

5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Answer:

The sequence mRNA is the coding strand of DNA except that thymine is replaced by uracil. Thus, the sequence of mRNA will be

5' - AUGCAUGCAUGCAUGCAUGCAUGCAUGC - 3'.

5. Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNAreplication? Explain.
Answer:

The property of DNA double helix which led Watson and Crick to hypothesize semi-conservative mode of DNA replication is that the two strands of DNA are antiparallel and complementary to each other in terms of their base sequences. This arrangement suggests that DNA replication is semiconservative. During replication, the two strands unwind and each strand acts as a template for the synthesis of a new strand. At the end of replication, DNA of parental types and recombinant types are formed.

6. Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic acid polymerases.
Answer:

Depending upon the chemical nature of the template nucleic acids synthesized from it (DNA or RNA), two are found

a. DNA dependent DNA polymerase - it uses DNA as a template to synthesize new strands of DNA.

b. DNA dependent RNA polymerase - It uses DNA as a template to synthesize RNA.

7. How did Hershey and Chase differentiate between DNA and protein in their experiment while proving the DNA is the genetic material?
Answer:

Alfred Hershey and Martha Chase (1952) worked with a virus that infects bacteria called bacteriophages. They used different radioactive isotopes to label DNA and protein. In their experiment, in one preparation, the protein part was made radioactive and in the other, nucleic acid (DNA) was made radioactive. These two phage preparations were allowed to infect the culture of E.coli . Soon after infection, before the lysis of cells, the E.coli cells were gently agitated in a blender, to loosen the adhering phage particles and the culture was centrifuged. The heavier infected bacterial cells pelted to the bottom and the lighter viral particles were present in the supernatant. It was found that when bacteriophage containing radioactive DNA was used to infect E.coli, the pellet contained radioactivity. If bacteriophage containing a radioactive protein coat was used to infect E.coli, the supernatant contained most of the radioactivity. Their experiment showed that protein does not enter the bacterial cell while DNA gets transformed. Hence, they prove that DNA is the genetic material.

8. Differentiate between the followings:

a. Repetitive DNA and Satellite DNA
Answer:

b. mRNA  and tRNA
Answer:

c. Template strand and Coding strand
Answer:

9. List two essential roles of ribosomes during translation.
Answer:

The ribosome is a complex structure made up of ribonucleoproteins. It consists of two subunits i.e. a larger subunit and a smaller subunit. The essential roles of ribosomes during translation are as follows:

a. Ribosome acts as the site of protein synthesis.The larger subunit ribosome acts as an amino acid binding site while a small subunit attaches to the mRNA.

b. Ribosome acts as a catalyst for forming peptide bonds

10. In the medium where E. coli was growing, laCTose was added, which induces the lac operon. Then, why does lac operon shut down sometime after addition of lactose in the medium?
Answer:

Lac operon refers to a segment of DNA which consists of one regulatory gene (i) and three structural genes (y,z and a). Among the three structural genes, the z gene code for enzyme beta-galacto ida e, t at is responsible for the hydrolysis of the disaccharide lactose into its monomeric unit , galactose and glucose. Gene y code for enzyme permease, which increases the permeability of the cell. The gene encodes for enzyme transacetylase. Lactose which is called the inducer is the substrate for enzyme beta-galactosidase and it regulates switching on and off of the operon. The regulatory gene, I code for the repressor of the lac operon. Lactose can bind to the repressor and inactivate it. When lactose is bound to the repressor, the RNA polymerase binds to the promoter of the lac operon. As result of this, the transcription of three structural genes takes place and they form their respective enzymes. Further, these enzymes metabolize the lactose and lead to the formation of glucose and galactose. When the lactose metabolism is at its highest, the repressor protein is set free to bind with the operator gene. As a result of Thus, the transcription of lac operon stops. Therefore, lac operon shuts down sometime after addition of lactose in the medium.
 

11. Explain (in one or two lines) the function of the followings:

a. Promoter
Answer:

Function of promoter - Promoter gene refers to the site where the RNA polymerase enzyme binds and transcription of mRNA starts.

b.tRNA
Answer:

Function of tRNA - tRNA plays a major role in the process of protein synthesis. It reads the genetic code present on mRNA.

c.Exon
Answer:

Exons are the coding sequences on DNA that transcribe into proteins.

12. Why is the Human Genome project called a mega project?
Answer:

The Human Genome project is called a mega project because it's specific goal is to sequence every base pair in the human genome . HGP took approximately 13 years to accomplish in 2006. The main aim of HGP was to develop new technology and generate new information in Genomic Studies. Because of this project, many new areas have opened in genetics. Thus HGP is a mega project.

13. What is DNA fingerprinting? Mention its application.
Answer:

DNA fingerprinting is a very easy and quick way to compare the DNA sequence of any two individuals. It includes identifying differences in some specific regions in DNA sequences called repetitive DNA sequences. In these regions, a small stretch of DNA is repeated many times and they are specific for every individual. The technique of fingerprinting was initially developed by Alec Jeffrey.

Applications of DNA fingerprinting

a. It is used in forensic science in order to identify individuals.

b. It can be used to establish paternity or maternity related disputes.

c. DNA fingerprinting is used to establish Evolutionary Relationship between organisms.

14. Briefly describe the following:

a. Transcription
Answer:

Transcription- It refers to the process of copying gene ic information from one strand of DNA into mRNA. In transcription, only one strand is copied into the RNA. While copying, the place of adenine is taken up by uracil. The transcription of DNA includes a transcription unit. The transcription unit consists of a promoter, the structural gene and terminator.The strands that have polarity 3’-5' act as a template and are called template strand while the other strand is called coding strand. A schematic structure of a transcription unit is given below.

The promoter is located at the 5’ end and it binds the enzyme RNA polymerase to start transcription. Sigma factor also helps in initiation of the process of transcription.The terminator is located at 3’end of coding strand and usually defines the end of transcription where rho factor will bind to terminate transcription.

b. Polymorphism
Answer:

Polymorphism- It refers to a special kind of genetic variation in which nucleotide sequence can exist at a particular site in a DNA molecule. This heritable mutation is caused due to a mutation in either somatic cell or in the germ cell. It ultimately results in the accumulation of various mutations at one site. Polymorphism brings revolution in the process of finding a location on the chromosome for disease-associated sequences and racing human history.

c. Translation
Answer:

The Process Polymerisation of amino acids into a polypeptide chain is referred to as translation. The order and sequence of amino acids in a polypeptide chain is dependent upon the base sequence of mRNA. Process of translation involves three steps i.e. initiation, elongation and termination. During the initiation, the ribosome binds the mRNA to the tRNA codon which is AUG. Ribosomes further move from codon to codon along the mRNA for elongation of the polypeptide chain. In the end, the release factors bind to the stop codon, leading to the termination of translation and release of the polypeptide from the ribosome.
 

d. Bioinformatic
Answer:

Bioinformatics, It is a recent and very effective area in sheffield biology.In The Discipline, the knowledge from the DNA sequences is used for solving various doubts regarding organisms which can not be studied on them in real-time. Therefore, we can say that we utilize the biological information stored in the DNA of an organism.

Molecular Basis of Inheritance Important Questions

Q1. What is the significance of the Human Genome Project in understanding inheritance?
Answer: The Human Genome Project mapped the entire human genome, identifying over 20,000 genes. It significantly advanced our understanding of genetic diseases, inheritance patterns, and human evolution. This project has led to breakthroughs in personalized medicine, allowing for tailored treatments based on individual genetic profiles and improving diagnosis and prevention strategies for various health conditions.

Q2. How does DNA fingerprinting work and what are its applications in genetics?
Answer: DNA fingerprinting analyzes unique patterns in an individual's DNA, often focusing on short tandem repeats (STRs). This technique is widely used in forensic science for crime scene investigations, paternity testing, and genetic studies. By comparing DNA samples, scientists can determine relationships between individuals and identify suspects or relatives, making it a crucial tool in legal and medical fields.

Q3. What are the key differences between DNA and RNA in the context of genetic information?
Answer: DNA (deoxyribonucleic acid) is double-stranded and stores genetic information, while RNA (ribonucleic acid) is usually single-stranded and plays a role in protein synthesis. DNA contains deoxyribose sugar, while RNA has ribose sugar. Additionally, DNA uses thymine as a base, whereas RNA uses uracil. These differences affect their functions in inheritance and cellular processes.

Q4. How does the genetic code determine protein synthesis in living organisms?
Answer: The genetic code consists of sequences of nucleotides in DNA that dictate the sequence of amino acids in proteins. During transcription, DNA is copied into mRNA, which then undergoes translation at ribosomes. Each set of three nucleotides (codon) on the mRNA corresponds to a specific amino acid, ultimately forming proteins essential for cellular functions and development.

Q5. What are the mechanisms of gene regulation and why are they important for cellular functions?
Answer: Gene regulation involves processes that control gene expression, ensuring that genes are turned on or off as needed. Mechanisms include transcription factors, epigenetic modifications, and RNA interference. This regulation is crucial for maintaining cellular functions, responding to environmental changes, and allowing cells to differentiate, ensuring proper development and functioning of organisms in various conditions.